lunes, 13 de septiembre de 2010

cita petoulquiana: otra sobre el anarquismo

"En la actualidad surge el 'Anarquismo ético', que es la doctrina que busca suprimir el Estado. Rechaza lo normativo. Sus partidarios son enemigos de toda norma y todo valor y, consideran que el Derecho, la Moral, los Convencionalismos Sociales y la Religión nacieron de la ignorancia, la maldad y el miedo."

No tengo ni idea de cuál es la fuente. El flammer sacó esto de algún librejo de ética que consultamos para el temario de graduación hace miles de años. Bien, flammer; nos dejaste este tesorazo.

domingo, 12 de septiembre de 2010

capítulo quincuagésimosegundo: ¿inception...?

Hace unos años publiqué en el diario que tenía en una red social (hi5, valga la publicidad tardía... el sitio está muerto de todas maneras) un cuento mío que titulé "Ciclo de Clonación: Completo". Algunos de mis amigos me comentaron el gran parecido que encontraban entre mi cuento y el fime "The Prestige", el cual yo no había visto.

Cuando publiqué mi cuento una vez más, esta vez en el blog, me comentaron lo mismo, que "Ciclo de Clonación..." se parecía excesivamente a "The Prestige". Insisto, yo nunca había visto el filme, solamente el trailer, pero no tenía ni idea de cuál era el concepto general.

Hace unas semanas, vi finalmente "The Prestige" y me gustó muchísimo. Claro, algo tendría que ver que el director de esta película fue Chris Nolan, quien también dirigió "Batman Begins" y "The Dark Knight" (ésta última yo la considero la mejor cinta basada en un cómic).

Anoche vi "Inception", el último filme de Nolan. Tenía muchas ganas de ir al cine y apreciarla bien. Quedé completamente satisfecho, pero sé que mi opinión no cuenta mucho porque podría ser algo parcializada debido a mi gusto por el trabajo de este creador cinematográfico.

Por otra parte, me interesó muchísimo el concepto central de la película, el cual le da el título: el poder sembrar la inspiración en la mente de otra persona.

No me extrañaría, aún cuando no entendería el propósito de ello, que "alguien" hubiera sembrado en mi mente la idea que dio lugar a la creación de "Ciclo de Clonación: Completo"; y esto explicaría el hecho de que haya escrito un cuento corto tan similar, en concepto, a una película que no había visto hasta entonces.

martes, 27 de julio de 2010

capítulo cero: cero

Ciertamente, me pregunto, ¿cuál es la diferencia entre la vida y la muerte?

No es una pregunta afectada, ni una línea llamativa para atraer su atención (la de Vds., quienes quiera que sean). No. Es simplemente algo que ronda mi mente desde hace algún tiempo.

¿Por qué ronda mi mente? Bueno, porque ya no soy tan joven. Sí, soy joven, pero no tanto.

Y también porque he visto irse a otros. Y al decir "irse", quiero decir "morir". No los he visto agonizar, si he de ser preciso, pero sí he notado su desaparición física.

Todos hemos de morir, es algo con lo que nos familiarizamos. En mi realidad, nuestra (para quienes la comparten conmigo), es algo más que evidente, patente, de todos los días: cotidiano.

Pero el asunto es, si vamos a morir, ¿cuál es el objeto de todo? ya hace tiempo me lo respondí: ninguno. Talvez no se trate de un objeto, ni siquiera de un sujeto... ¿tal vez de un "adjeto" (neologismo absurdo o término que desconozco y por tanto asumo como inexistente)?

No es este alegato una especie de monólogo de "ser o no ser", ni de broma trato de establecer que aquí haya un dilema en ese sentido. Sólo me pregunto si hay una diferencia... ontológica creo que es la palabra, entre la vida y la muerte. Y sé que mi pregunta no puede ser respondida. A lo mejor sólo ignorada, pasada por alto. Pero es recurrente, y supongo que lo será hasta el fin de mis días, cuandoquiera que suceda. Mientras, sigo en el cero.

jueves, 24 de junio de 2010

capítulo quincuagésimoprimero: peto lloyd


Peto Lloyd salió de su casa esa mañana. Llevaba su maletín y su guitarra (porque es maestro de música), iba más cargado que de costumbre, pero andar cargado ya era su costumbre.

Vio hacia el cielo, aspiró fuertemente, sonrió y se dispuso a vivir el mejor día de su existencia.

Justo se encontraba en la esquina cuando se topó con el primer obstáculo: la gran cantidad de automotores que veloces como bólidos recorrían la primera calle, la cual lo separaba de la otra acera.

Reunió todas sus energías y se dispuso a pasar raudo como cohete, se lanzó en cuanto vio un pequeño estrecho entre los autos, esquivó uno que venía justo en colisión hacia él, actuó como el “Manolete” con cuantos vehículos se lanzaron contra él. Llegó a salvo a la acera y ¡zas! Se resbaló con el aceite que había quedado en donde ponían el puesto de pollo con papas...

Y casi cayó sentado, porque es mejor “casi caerse” que “casi no caerse” (y Peto se ha ejercitado en el arte de lo primero), se levantó y de repente se dio cuenta que las suelas de sus zapatos se deslizaban sobre el suelo mojado, así que si trataba de caminar rápidamente patinaba por la acera, en virtud de lo cual dio una demostración magistral de patinaje artístico. Dando piruetas llegó hasta donde se encontraba un árbol, al cual trepó sin saber bien cómo, se lanzó desde éste hasta el techo de la camioneta más cercana, la cual se encontraba en movimiento, como todas las demás en cuyos techos aterrizó después de pegar fuertes y ágiles saltos, todo para evitar a la muchedumbre agolpada en la terminal de buses anexa al mercado. Cuando llegó a la “Calle Martí”, en vez de usar la pasarela como cualquier cristiano, arremetió contra el tránsito, esquivó por poco un gigantesco trailer, trepó sobre un pequeño carro compacto, viajó unos metros sobre los hombros de un motorista, saltó sobre el techo de dos camionetas más, y descendió suavemente sobre la acera en que había planeado esperar su bus.

Cuando vio que se acercaba el bus de la ruta que esperaba, le indicó que deseaba abordarlo, el automotor se detuvo, Peto intentó montarse, pero falló al tratar de agarrarse del tubo, se resbaló y... se pegó tremendo sopapo contra el piso. ¿Qué se creían? ¿que esto era una película muda?




Imagen:

http://thesituationist.files.wordpress.com/2007/06/harold-lloyd-help.jpg

lunes, 21 de junio de 2010

capítulo quincuagésimo: cándido

"Como vos, Cándido, mis primeras letras las aprendí en un castillo donde todo era felicidad. Pero, nada de eso puede durar permanentemente." Le dijo Peto al hijo literario de Voltaire.

"Últimamente, ya no creo que vivamos en 'el mejor mundo posible'; quizás no sea 'el peor mundo posible', pero definitivamente no está nada bien. Y todavía hay quien se obstina en que veamos 'la belleza del mundo'... no, no es que crea que no existe la belleza, pero no creo que sea la que mencionan los optimistas, los cándidos (no te sintás aludido)." Peto había comenzado a discursear, lo cual significaba que Cándido seguramente no tendría la oportunidad de decir una palabra.


"Soy un pesimista, ya lo sé. No puedo evitarlo, ni quiero hacerlo en realidad. Así soy yo."

Cándido sonreía de una manera aparentemente ingenua, afable. Pero Peto sabía que la ingenuidad ya no existía más en su interlocutor, que entre ellos dos no había ni un gramo de confianza en la bondad del ser humano (bueno, quizás un poquitín... no hay que exagerar, porque sería una falacia por generalización, blablablá).

"Mejor me voy a trabajar en mi jardín." Dijo Cándido, y se fue.

miércoles, 16 de junio de 2010

Paréntesis: Importante: Ver "Importante"

Ya se me estaba olvidando, pero lo bueno es que me acordé. Quiero recomendar ver "Importante", un corto producido, escrito, dirigido y actuado por guatemaltecos, aquí la descripción que aparece en Youtube: "... primer cortometraje de Jorge Cabrera. Cuenta con Rafael Romero como protagonista y la producción de "Los Guates", un grupo de amigos guatemaltecos que residen en España. Fue rodado en Madrid durante el verano del 2009 por las calles de Lavapiés, las estaciones de Sol, Embajadores y Delicias, y en las casas de Javier, María y Pablo."

He aquí el link para la página oficial:

http://importante.sinctrl.com/

Para verlo y comentarlo.

Y también aquí está el corto:





Video:

http://www.youtube.com/watch?v=1X9_ilewmIU&playnext_from=TL&videos=lp91teJTMZY

capítulo cero: el acto de desaparición

Desde que era niño, siempre me ha parecido fascinante el acto de desaparición. Claro es, cuando era niño, el acto de desaparición tenía una naturaleza distinta (para mí, en todo caso). Recuerdo una vez, en una fiesta infantil, presenciando cómo un mago hacía desaparecer a un niño dentro de una especie de armario para luego reaparecerlo. En esa ocasión me pregunté, "mientras no lo vimos, ¿adónde fue ese niño?". Parecerá una tontería pero todavía pienso al respecto; no acerca de adónde fue el niño, seguramente había una puerta secreta o algún otro truco, sino ¿adónde vamos cuando desaparecemos?

Ciertamente, a veces quisiera tener el poder no de desaparecer a otros sino de poder desaparecer yo.

capítulo cuadragésimonoveno: cuatro veces menos juicioso

Cuando a Peto le extrajeron la cordal inferior izquierda, el cirujano le explicó: "Tuvimos problemas para extraerla porque sus raíces estaban retorcidas y orientadas en direcciones opuestas."

"Eran raíces quiméricas." Pensó Peto; y no le extrañó, porque todo en él es sinuoso.

¿Sinuoso? Tortuoso sería quizás un sinónimo más apropiado por lo torturado de su espíritu melodramático.

Mientras le retiraban esa parte de él, la muela de la sabiduría (wisdom tooth, porque aparece con la "madurez", jaja) como le llaman los anglosajones, Peto no podía evitar pensar en lo frágiles que somos los humanos y cuán fácil es desbaratarnos y recordarnos nuestra material existencia. Así que le desprendían una parte de sí, reflexionaba en que él no era (no es) sino un montón de huesos, músculos, vísceras y nervios, una especie de máquina (¡¡¡¿extraordinaria?!!! ¿a quién se le ocurre?). Y como cualquier máquina podía (y puede) ser desmantelado y desechado. Fue imposible para Peto el no sentirse cosificado, puesto en su lugar en el universo (que conspira para nuestra felicidad).

Las cordales superiores fueron presa fácil del exodoncista (¿neologismo, o ya existe esta palabra?) lusiférgico. Tardó como quince minutos en sacar las dos.

Pero la inferior derecha, aún cuando tomó menos tiempo en salir, implicó una operación más traumática.

Al carajo, después de tres, una más ya no nos asombra tanto. Claro, las raíces de ésta eran tan sinuosas, tan tortuosas, tan quiméricas, que algo de eso debió dejar a Peto con los pedazos de calcio que se le desprendieron; pero no, sólo se fue un cuarto más de su juicio. La quimera sigue ahí, en la sima que quedó tras la excavación, tan profunda y pavorosa como el hoyo de la zona 2.

Paréntesis: Ya no sé ni cómo se escribe un paréntesis

Resulta que después de tanto tiempo sin escribir, comienzo a olvidar cómo hacerlo. Sin embargo, como dice el viejo refrán (¿o será proverbio... o quién sabe?) "lo que bien se aprende nunca se olvida". Y los viejos vicios son difíciles de matar (o como se diga).

Así que, me parece que lo adecuado es volver a escribir, tanto como pueda, aún cuando siempre me ha importado más la calidad que la cantidad. Mas, en ausencia de ambas lo que procede es hacer algo, y ver qué sale.

Algunos cambios: Adiós al Petoulqui Acústico (esa aplicación disfuncional como yo, con una lista de piezas musicales varias que ya no suenan porque no su reproducción no está disponible aquí en Guatemala); y una nueva plantilla para el blog.

domingo, 30 de mayo de 2010

cita petoulquiana: amistad

"Pensaba en aquella mona domesticada, tan amiga de los hombres, que jugaba con ellos, comía con ellos, pero que un día reconoció en el asado, presentado en una fuente, a un hijito suyo, lo cogió apresuradamente, se fue corriendo con él al bosque, y no volvió a aparecer entre sus amigos los hombres..."

Noches Florentinas, Segunda Noche. Heinrich Heine.

domingo, 23 de mayo de 2010

cita petoulquiana: metamorfosis

"Una vez Chuang Chou soñó que él era una mariposa, una mariposa revoloteando alrededor, feliz consigo mismo y haciendo lo que le placía. Él no sabía que era Chuang Chou. Repentinamente despertó y allí estaba, sólido y sin lugar a dudas Chuang Chou. Pero él no sabía si era Chuang Chou quien había soñado que era una mariposa, o una mariposa soñando que era Chuang Chou. Entre una mariposa y Chuang Chou ¡tiene que haber alguna distinción! Esto es llamado, la Transformación de las Cosas."

(¡¿La Metamorfosis?!)


Zhuangzi. Zhuangzi, Capítulo 2.

sábado, 15 de mayo de 2010

cita petoulquiana: máquinas

"Le confesaré, María, que el hecho de que Inglaterra no me acabe de gustar nada, ni en sus hombres ni en su cocina, depende, en parte, de mí mismo. Llegué de mi tierra con una buena provisión del mal humor y buscaba solaz precisamente en un pueblo que mata su aburrimiento con el vértigo de la actividad política y mercantil. La perfección de las máquinas, que allí se aplican en todas partes y que toman a su cargo muchas operaciones, antes reservadas a los hombres, me producía un efecto siniestro. Ese mecanismo artificial de ruedas, palancas, cilindros y miles de clavos, ganchos y dientes pequeños, que se mueven casi apasionadamente, me llenaba de horror. Lo preciso, lo exacto, lo medido, la puntualidad con que se realiza la vida de los ingleses no me atemorizaba menos. Pues si en Inglaterra las máquinas nos parecen hombres, los hombres, a su vez, nos parecen máquinas. Dijérase que la madera, el hierro y el latón han usurpado el espíritu del hombre y se han vuelto casi locos de puro exceso espiritual; mientras que el hombre, desespiritualizado, realiza como un espectro, maquinalmente, sus negocios habituales, toma en el preciso momento sus biftecs, pronuncia discursos parlamentarios, se cepilla las uñas, monta en el Stage Coach o se ahorca."

Heine, Heinrich. Noches Florentinas, Segunda Noche.

miércoles, 5 de mayo de 2010

capítulo cuadragésimooctavo: política animal IV "el pájaro loco, el zope y los conejos"


Y así, aún cuando no soy amante de los animales sigo teniendo episodios en los cuales sufrimos encuentros los animales irracionales y un servidor, nada menos que un irracional animal racional.

Cuando caminábamos con Myr por Yavin IV (la primera vez que estuve ahí), después de haber recorrido un solitario sendero nos encontramos con algo que me pareció maravilloso: un pájaro carpintero. Para mí era algo extraordinario (y creo que para Myr también) porque nunca había visto uno (claro está, si descontamos al "Pájaro Loco" , quien me acompañó en mi niñez, garantizando que, según ciertos investigadores, fuera sedentario, solitario e ineficaz para las matemáticas). Una vez, alguien me había contado cómo había visto un pájaro carpintero en El Cerrito del Carmen; yo vivo enfrente y nunca vi uno, tuve que ir hasta Tikal para encontrarlo, digo para que nos encontráramos los tres: Woody, Myr y Peto.

Ahora bien, una noche fuimos con Myr a comprar amoxicilina a una farmacia que queda en la Calle Martí; era considerablemente tarde y ya saben cómo es nuestra ciudad. Dos señoras observaban asombradas lo que parecía un chompipe (pavo para los que no sepan, alusión no intencionada para el flammer), un ave grande y oscura; al ver detenidamente me di cuenta de que era, en realidad, un zopilote. Me sentí hipnotizado por la criatura carroñera, quizás porque me pareció que tenía enfrente a un emisario de la muerte, a lo mejor un simple acompañante. Y esto me hace recordar todas las veces que he visto zopilotes en distintas circunstancias: posados en un árbol, comiendo carroña en una llanura... pero lo extraño era que el zope estuviera en tierra, cerca de una de las arterias principales de la capital y solo. Era claro que no podía volar; me imaginé lo indefenso que debía de sentirse (aún cuando todavía le quedaban su pico y garras carroñeras que, desesperadas, seguían siendo capaces de picar y desgarrar). Hallar a ese zope en esa circunstancia ha sido uno de los mayores extrañamientos de mi vida.

Y finalmente: los conejos. No sé si fue porque al fin publiqué "El conejo saltó" pero hace unas noches soñé que mi habitación era invadida por conejos: blancos, moteados; grandes, pequeños; diversos en su constitución. Recuerdo que los levantaba atenazando sus suaves pellejos peludos y los echaba, pero volvían a entrar; entonces descubría que había un agujero en la pared, justo detrás de una librera que hace las veces de "disquera". Los conejos cumplían su cometido a cabalidad: se reproducían rápida e incesantemente. Yo no sueño con serpientes, sólo con conejos, en una especie de plagio onírico de "Carta a una señorita en París" de Julio Cortázar...




sábado, 1 de mayo de 2010

Cuento original: El conejo saltó (5 de 5: final)

5

Cada vez se olvidaba más. Así lo había querido. Él buscó hundirse en el olvido, en la oscuridad más absoluta. Quería huir de la memoria, del pasado que le perseguía como el más tenaz cazador.

A cada salto que él daba, el pasado ya estaba sobre él. Claro es, el pasado estaba siempre a la zaga. Eso era lo malo, que a la zaga o como fuera, siempre estaba, siempre. El pasado era implacable. Era como si él, aún cuando iba adelante, atizara al pasado por detrás. Pero no, sin distorsiones de lo lineal, se podría decir que él jalaba del pasado como un caballo tira de una carreta.

Cada vez se olvidaba más de quién era él, de qué era. No quería ya saber de donde venía, ya no quería tener a donde ir, ya no quería querer.

Comenzó a hundirse y se olvidó de los porqués y para-qués. Ya no comía por apetito o para nutrirse, lo hacía por costumbre.

Así, un día se olvidó de por qué huía y para qué. Y simplemente huyó.

Pero ahora ocurría lo inverso, estaba recordando, no porque quisiera sino porque así es la vida: impredecible.

Ahora recordaba que tenía miedo, recordaba porqué lo tenía. Y sentía angustia, pensaba acerca del pasado (con remordimiento) y acerca del futuro (con ansiedad).

En determinado momento se preguntó algo que, al siguiente instante quiso olvidar, “¿quién soy?”

...

El conejo saltó. Siempre había estado al borde, pero se aburrió de estar así. Saltó al vacío y cayó, pero no se estrelló contra el suelo, solamente siguió cayendo. Ya una vez había experimentado el ir hacia abajo, siempre más y más hacia lo profundo, pero ahora era distinto...

De la oscuridad, de la boca negra y redonda, antítesis de la blanquísima esfera de la luna, un conejo saltó. Todos los niños le aplaudieron al mago que acababa de hacerlo aparecer, sacándolo de su chistera, extrayéndolo de la nada, donde todo simplemente cae sin tocar fondo.

Sí, el conejo, blanquísimo, contrastante con la negrísima y lustrosa chistera, asomó primero el hocico, con su bigotes, luego sus ojos rojos, y después, perdiendo toda la timidez, como si cambiara de piel, de piel de conejo, tomando impulso...

El conejo saltó.

jueves, 29 de abril de 2010

Cuento original: El conejo saltó (4 de 5)

4

“Es una operación de rutina”, dijeron. “No hay de qué preocuparse.”

Claro, porque “ellos” no eran el sujeto de operaciones y, pasara lo que pasara, se sobreentendía que para con el suprascrito sujeto no existía obligación legal alguna, y aún menos, según el criterio de “ellos”, consideraciones morales al respecto.

La lámpara del quirófano enceguecía a la víctima. Era palpable en sus ojos la percepción de que la cirugía era inevitable. Cuando le acercaron el pañuelo con cloroformo, como una mordaza, trató de oponerse con sus manos.

A uno de los cirujanos se le hizo un nudo en la garganta. Le pareció conmovedor el acto de resistencia final.

“Casi llego a creer que sabe lo que le va a pasar.” Pensó. Y en su fuero interno, casi quiso detener la operación, pero sabía que esta cuasi-intención y la revelación de su cuasi-creencia le acarrearían, ante sus compañeros y el señor profesor, una calificación de “débil e incompetente” y, por lo tanto, una descalificación profesional. En virtud de lo cual, se quedó callado, como casi siempre hacía; en verdad, había detalles que le gustaban y otros que le disgustaban de su quehacer.

Al final, la víctima pareció quedar en estado de inconsciencia. Se veía aún más tierna dormida. El corazón del cirujano con crisis de conciencia comenzó a latir rápidamente. Sintió que el sudor le mojaba los bigotes. De pronto, se dio cuenta que le hablaban, “Deje de soñar despierto. Preste atención.”

“En este momento, vamos a abrir la cavidad toraco-abdominal. Queremos observar el corazón (¡tacatacatacatacatacatacataca!) y los pulmones.” Indicó el señor profesor.

De repente, la víctima abrió los ojos y chilló horriblemente, “¡¿Por qué me hacen esto?!”

“¡Qué chillido más espantoso!” Pensó el cuasi-cirujano de la cuasi-crisis de conciencia. “Es como si fuera uno de nosotros.” Sí, en efecto, era como si la víctima fuera uno de “ellos”. Nunca le había parecido más evidente que ahora.

El otro cirujano, el de a la par, tenía los ojos desorbitados; de por sí, estos eran saltones, pero ahora parecía que iban a salir disparados como balas de cañón.

La angustia fue general.

“Como si fuera uno de nosotros.” Resonaban las palabras en el cuasi-crítico cuasi-cirujano, estudiante.

“Mantengan la calma, señores.” Repetía el señor profesor, con tremenda, cruel, fría serenidad indiferente. “No es para tanto.” Concluyó después de sopesar el asunto en esa balanza en la cual su corazón de piedra era, terminantemente, más pesado que el sufrimiento de un ser irracional.

La criatura, la víctima, no dejaba de retorcerse en la agonía que le causaba el estar herida mortalmente.

Ahí estaba el sujeto de operaciones, con su piel desnuda, sus ojos suplicantes, con lágrimas, escurriéndole como gotas de amargo dolor. Y el señor profesor decía, “No es para tanto.”

El cuasi-cirujano sufrió la escena, con los bigotes empapados en sudor, el corazón latiéndole enloquecido (¡tacatacatacatacatacatacatacatacatacataca!). Por la noche le contó el suceso a su familia y, consternado, se fue a dormir.

“No me gustaría que eso me pasara a mí.” Pensó, muy asustado. Se rascó la oreja, se quedó dormido y soñó.

Soñó que un grupo de seres humanos, con su piel desnuda y sus ojos expresivos, lo diseccionaban a él. ¿En qué mundo retorcido cabía que fueran los seres humanos quienes diseccionaran a otros seres? Era algo imposible, pero en su sueño así sucedía. Cuando el señor profesor humano realizaba la incisión descubrían, bajo su piel de conejo cuasi-cirujano, no la carne y las vísceras de un conejo, sino a un ser humano. Un ser humano bajo el disfraz de un conejo.

“¡Como uno de nosotros!” gritaban horrorizados los cirujanos humanos, y sus gritos y expresiones de repulsión iban en crescendo.

“¡¿Por qué me hacen esto?!” Gritó el cuasi-cirujano cuasi-conejo (en virtud de que en sus entrañas había un desnudo y expresivo ser humano) y entonces supo cuál era el significado del, hasta entonces para él, incomprensible gemido de aquella pobre víctima, sujeto de operaciones, cuyo sufrimiento no era para tanto, pues para con una criatura irracional no había ninguna clase de obligaciones legales ni, mucho menos, morales.

Desesperado, el conejo saltó.

domingo, 25 de abril de 2010

Cuento original: El conejo saltó (3 de 5)

3

Adentro, siempre más adentro. Enterrándose cada vez más. Hacia lo oscuro, hacia ninguna parte, hacia lo desconocido.

No hay un camino definido, todo está enredado; sin embargo, una madriguera no es una prisión, más allá de la falsa impresión que podría causarnos la oscuridad y el espacio reducido de este refugio. Es, más bien, un laberinto. No, un laberinto no puede ser, porque una madriguera, a diferencia de un laberinto, no tiene solamente una salida sino muchas. Pero él no quiere salir. Lo que quiere es hundirse cada vez más en la tierra. Ya una vez salió de la tierra; pero siempre quiso regresar a ella...

sábado, 24 de abril de 2010

Cuento Original: El conejo saltó (2 de 5)

2

Como un ojo gigantesco, la luna lloró cuando el conejo saltó. Una lágrima gigantesca cayó sobre la tierra. Los árboles se veían distintos aquella noche y la tierra estaba dura. No había monte para comer, así que tenía hambre.

Había monstruos con los ojos luminosos. Miles de monstruos.

Por un momento sintió que el corazón se le salía del pecho: ¡tacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacataca!

Todo era ruido y esa luz extraña... y frío... y dureza. El mundo no era el mismo y, aún cuando no lo sabía, él tampoco lo era.

Miedo, confusión. Él no terminaba de entender (ni siquiera había comenzado a hacerlo, realmente), ¡las estrellas estaban tan cerca del suelo y parecían tan frías! Esto era el infierno, ni más ni menos (Xibalbá decían unos, el averno dirían otros...).

¿Y ahora qué?

Saltó...

El conejo saltó. Saltó como nunca lo había hecho. Sin embargo, saltar no es volar, así que comenzó a caer otra vez (ocurrencias de Newton, “todo lo que sube...”). Cuando cayó, todo a su alrededor resonó y hubo un ligero temblor. Su golpe había sido como un relámpago. No, su golpe había sido como el de Cabracán, el destructor de montañas. Él, simple conejo, era como un volcán en erupción, como la lava que esperaba debajo de la tierra, paciente, para explotar con violencia en determinado momento. ¿Quién determinaba el momento? Él, simple conejo.

Él, simple conejo, era (ahora lo veía): miedo invencible en los corazones de los demás seres.

Pero, aún ahora sentía miedo. También el suyo era miedo invencible. Él era el trueno, el volcán, el terremoto... el simple conejo... conejo asustado...

Así que, en medio de la extraña luz ámbar de esa extraña noche (ruidosa noche, llena de monstruos y árboles luminosos), una y otra vez...

El conejo saltó.

lunes, 19 de abril de 2010

Cuento Original: El conejo saltó (1 de 5)

1

Ve a la luna: su ojo y ella brillan sin luz propia. Si la fuente de luminosidad de la cual dependen se apagara, tanto el órgano visual como el satélite, inevitablemente, también lo harían; son poca cosa, son dependientes.

...

La luna llena brilla azul en el firmamento; es como un ojo gigantesco observándolo todo, porque puede fijar su vista en los trescientos sesenta grados de la bóveda celeste (si se la partiera en dos, cada mitad del ojo lunar, abarcaría ciento ochenta grados, es decir, cada uno poseería una visión periférica. Pero no, la luna es una).

El globo brilla cada vez más y se infla; ahora, en su pureza, que se ha tornado blanca, aparece una mancha, la mancha crece hasta casi cubrir por completo la esfera. Crece y decrece, palpita, parece que el ojo se acercara y alejara alternativamente, un juego óptico causado por la luz que encandila y, de repente, casi se apaga, cubierta por la negra sombra de la mancha.

La mancha parece un ser desarrollándose; crece y su forma cambia. Es un embrión... ahora un feto, ni más ni menos... pero, ¿un feto de qué?

En estado fetal todos los seres parecen más o menos iguales, su cerebro, su espina dorsal, sus extremidades son similares, así que todavía no es posible distinguir su especie. El feto, la mancha, nada como un pez en la luz de la esfera, como un pez en su pecera.

Sus ojos son como dos lunas, no como una sino como dos, como una luna partida a la mitad, como dos mitades de luna pegadas en la cabeza de un ser, de un ser como todos los otros, el cual se alimenta, excreta, se mueve, porque es animal; un ser que todos los días siente cuando el sol roza el oriente y que cada noche contempla la luna, o siente nostalgia cuando ella no está.

Esos ojos, como mitades de luna, brillando ante la luz, ocultos en la oscuridad pero, ante todo, siempre observando, siempre, como si no tuvieran párpados.

La forma de la mancha, finalmente, comienza a definirse...



domingo, 18 de abril de 2010

cuento original: Te Prometo Anarquía

Este cuento fue publicado originalmente en "Amalgamas Errantes", edición conmemorativa del proyecto "Te prometo anarquía" (por eso la referencia al proyecto que encontrará quien lea el texto hasta el final). De hecho, se puede ingresar a "Amalgamas Errantes" haciendo clic en el botón del mismo nombre colocado en la barra de sugerencias, justo encima del botón de LunaPark.

...



“¡Anarquía...! ¡Anarquía...!”

“¡¿Y a Vds. qué les pasa?!” Pregunté a mis creaciones, sorprendido por sus gritos.

En vez de explicarme, continuaron con su consigna; me pregunté si la manifestación estaría relacionada conmigo. Cada uno de los personajes que había creado marchaba y vociferaba apasionadamente.

Súbitamente se detuvieron, su líder había hecho una señal con la mano indicándoles que se silenciaran. ¿Quién era su líder? Pues claro, el tal Petoulqui.

Se acercó a mí, tenía una expresión poco amistosa, más bien combativa, y me habló en los siguientes términos, “Hemos llegado a la conclusión de que no podemos permitir que nuestros destinos sean gobernados por Vd., de manera que a partir de este momento exigimos una total libertad para hacer de nuestra existencia lo que mejor nos parezca.”

“¿Y cuál ha sido el motivo de su decisión, queridísimo Peto?” Le pregunté.

“Pues, verá, Julio. Justamente ayer, cuando Vd. terminó de leer ‘Niebla’ de Don Miguel de Unamuno y Jugo, nos dimos cuenta de cómo son las relaciones entre autor y personajes. Nos ha parecido una abominación lo que el mentado Don Miguel hizo con Augusto Pérez. Y de repente, tomamos conciencia de que nosotros, en repetidas ocasiones, hemos sido tratados de manera similar; de modo que renunciamos a ser suyos y exigimos nuestra independencia.”

“¿Ah sí? ¿Y qué piensan hacer después...?” Le cuestioné, solamente para seguir con lo que para mí no era sino un juego.

“Pues... pues... “ Y Peto comenzó a trastabillar en su razonamiento, el cual según mi criterio ya había alcanzado su límite. “Pues ya habrá tiempo después para decidirlo...”

“Sí, como concluye Arthur C. Clarke su ‘Odisea Espacial’ ¿no es cierto? Acaso no te das cuenta, estimado Peto, que todas tus ideas no son sino las mías, y que las mías no son sino las de otros, que me antecedieron, de modo que si yo no soy original, ¿qué se han creído Vds. que son...?”

“...”

“Claro, si mi creador me hubiera dicho lo que les he dicho yo a Vds., seguramente también quedaría sin habla. Si no es que yo no crea en la anarquía, más bien... ¿cómo decirlo? Creo que para alcanzarla sería bueno saber primero qué se quiere.”

“Entonces, vamos por buen camino, eso lo sabemos: queremos nuestra independencia.” Me replicó.

“¿Y qué harán con ella?”

“Pues... pues...”

“Esto parece un carrusel...” Comenté con cierta mordacidad que sólo el Peto y yo podríamos tomarnos a mal.

Ah, lo que uno descubre si se pone a escribir en un procesador de palabras cuando la fecha de cierre está por llegar. Como Peto es mi... ya saben Vds., alter ego, se me había olvidado que tiene aproximadamente dos años de edad, es apenas un infante y tengo que educarlo, a veces con severidad, sacando el dictador que llevo dentro, para que aprenda lo que Platón enunció en su República: "El pueblo queriendo evitar, como suele decirse, el humo de la esclavitud de los hombres libres, cae en el fuego del despotismo de los esclavos, y ve que la servidumbre más dura y más amarga sucede a una libertad excesiva y desordenada.”

Y Vd., apreciable persona lectora, quizás se preguntará, “¿Y esto que tiene que ver con Te prometo anarquía?” Pues, la verdad, en cuanto a la forma, supongo que muy poco (o quién sabe), pero en principio estoy poniendo en práctica lo que para mí representa TPA: Expresión, libertad de elegir y que un tipo como yo pueda publicar sus conversaciones íntimas con los personajes de su-ficción.

domingo, 11 de abril de 2010

cita petoulquiana: amor de verdad

"... amar de verdad es amar para siempre..."

Intuído de las palabras de Don Miguel de Unamuno y Jugo (quien en el cuarto capítulo de su libro "Amor y Pedagogía" [Alianza Editorial. Primera edición, revisada en "Biblioteca del autor", quinta reimpresión. Madrid, 2008. p. 76] escribió: "- El héroe, sí, el que toma en serio su papel y se posesiona de él y no piensa en la galería, ni se le da un pitoche del público, sino que representa al vivo, al verdadero vivo, y en la escena del desafío mata de verdad al que hace de adversario suyo..., matar de verdad es matar para siempre... aterrando a la galería, y en la escena de amor, ¡figúrese usted!, no quiero decirle nada..."), en la voz de su personaje don Fulgencio, alumbrador de aforismos.

jueves, 8 de abril de 2010

capítulo cuadragésimoseptimo: ¡chupetéeeeeeeeeeeeeeeeee...!

El jueves santo pasado, fuimos con Lusifergua y Tato a ver pasar la procesión enfrente del Guacamolón (para quien no sepa: el Palacio Nacional de la Cultura). Por cierto, también iba la Aleíta.

Desde hacía mucho tiempo teníamos con Tato cierto antojo de chancaca ("Pedacito de chancaca, ¿va a poner atención?", nos decía Don Ángel); supongo que no es necesario explicar qué es la chancaca, dado que existe en muchos países de Latinoamérica, pero por si las dudas: la chancaca es un dulce elaborado con "rapadura" de azúcar, algo así como éste endulzante pero en bruto. Sólo que en Guatemala, según he podido apreciar (y si no me falla el gusto) le añaden pepitoria (nunca había escrito esta palabra). Pero lo de la chancaca vendrá después... si es que viene (tras haber visto y antes de vencer...).

Y así, nos paramos entre esa muchedumbre heterogénea, compuesta por hombres y mujeres, guatemaltecos y extranjeros, jóvenes y viejos, alcohólicos borrachos y alcohólicos anónimos, creyentes y herejotes, etc.

Ahí estaban todos los comerciantes tradicionales y menos que tradicionales, desde los que venden los clásicos "¡chupetéeeeeeeeeeeeeeeeeeeeeeees!" (el acento tiene que ir en la última sílaba, quien lo sepa me entenderá) hasta los que ofrecen (¿en una procesión?) fotos de modelos y actores (los de Crepúsculo, principalmente). De modo que no me fue difícil imaginar (antes de que pasara la procesión, por supuesto) una especie de batalla campal entres los vendedores; en la cual, claro está, llevarían las de ganar los de los ¡chupetéeeeeeeeeeeeeeees!

Para quien no haya visto un chupete guatemalteco, tiene que imaginarse un cucurucho con la punta hacia arriba y ya tiene la idea; son como una especie de lanzas medievales, pero dulces. Elaborados con una melcocha tan dura que, si se la muerde, uno podría quebrarse un diente.

Pero, volvamos a la chancaca. Como no hubo tal batalla campal (ni tengo tanta imaginación como para inventarme una y narrarla para Vds.), sigamos con el curso normal de los acontecimientos: Vimos el paso del cortejo procesional (tras notar, eso sí, que uno de los escudos de armas de la fachada del Palacete Nacionalete reza algo así como "Centroamérica Unida", ideal liberal digno del que mandó a construir semejante mamotreto arquitectonico), caminamos hacia la sexta avenida pasando por la Plaza de la Constitución y nos compramos una bolsita de chancaca (que por cierto, no estaba tan dulce).

jueves, 1 de abril de 2010

capítulo cuadragésimosexto: la nova de peto

Una vez, cuando Myr tenía como dos años, se subió a una silla para alcanzar el teléfono, descolgó el manófono (eso que usamos para hablar y escuchar... en ese orden, ya ven que no prestamos mucha atención), colocó el índice de su manita derecha en uno de los agujeros del disco de marcar, hizo que girara, se puso el auricular junto a su orejita y el transmisor cerca de su boquita...

Y cuando le preguntaron a quién estaba llamando, ella respondió con toda seguridad: "A mi novo..."

Era una llamada a través del tiempo y el espacio (prácticamente como cualquiera, pero...) hacia el futuro. Estaba llamando al Peto del mañana (es decir, el de hoy); porque Myr, para que lo sepan, sería (y es, evidentemente) la nova del Peto del hoy (el que para ella fue el de mañana).

Myr es la nova de Peto.

Diccionario petoulquiano: Cabroncito

Sust. Com. / Adj. (Zoología empírica cuasi-universal) Cabra macho grande chiquita. Aplícase para denotar admiración o desprecio.

sábado, 27 de marzo de 2010

capítulo cuadragésimoquinto: la petoúlquina en el zoo

Como siempre, según su lógica, todo era muy simple: era más fácil alegar en la taquilla que ella era una enana con tres hijos supercrecidos que declarar "tres adultos y una niña". Pero los grandes nunca entienden nada (algo así como lo que dijera el Principito). Así que no la dejaron realizar su plan.

Pero ingresaron al zoo. Lo primero que vieron fue el área que compartían las jirafas, cebras y cabras de no-sé-dónde; como las primeras tardaran en aparecer y las últimas hubieran estado ahí desde un principio, Tato no pudo evitar citar esa escena de Parque Jurásico en la cual le presentan una cabra al T-Rex para motivarlo a mostrarse y uno de los personajes, Grant creo, dice "El predador quiere cazar, no que le presenten la presa en bandeja..." o algo así. En esa parte del recorrido todos aprendieron que no es que las jirafas sean mudas sino que se comunican con infrasonidos. Y también descubrieron que las cebras no eran tales, sino caballos presos con su uniforme a rayas.

Y esto fue, quizás, lo más chocante, darse cuenta de que el zoo no es sino una prisión para animales. Según parece, algunos están ahí para "salvarlos de la depredación", así que se cumple aquello de que si le indultan la pena de muerte al reo, se la conmutan más bien por una cadena perpetua. Parece ser ésta la única elección que les queda a los animales.

No, me engaño, lo más chocante fue atestiguar el encierro en jaulas diminutas de aves rapaces que no están en peligro de extinción, y es que, si bien, se podría justificar la "conservación" de las especies en peligro, ¿cuál podría ser la razón de encerrar un ave (la cual por naturaleza necesita del firmamento) cuando su existencia no corre peligro en libertad? Hay cosas que, obviamente, ni la Petoúlquina ni Peto pueden entender... ni quieren hacerlo, ciertamente.

Peto se imaginó cómo sería un zoo no para humanos sino "de humanos", en el cual los animales pasearan mirando estupefactos a estas bestias bípedas y desnudas. ¿Qué pensarían? ¿Serían tan inhumanas como nosotros? Cualquiera podría alegar que sería un zoo aburrido porque sólo habría una especie en exposición, pero el ser humano es tan versátil que cada uno de nosotros sería una variedad aparte.

¿Conservación? ¿Privación de la libertad? Somos los seres humanos tan abominables que, para salvar a los animales de nosotros mismos, les robamos todo lo que son.

A Peto no le gustan los animales pero, muy ciertamente, tampoco las personas.

Ah, ya me acordé, este capítulo era sobre la Petoúlquina. Ella la pasó muy bien, hasta que dijo "estoy cansada, ya me quiero ir". Tuvo suerte, ella podía decidir cuándo marcharse, los residentes no.

jueves, 25 de marzo de 2010

Ficha personal

Petoulqui

Edad: 30 (Sí, ya sobreviví tres décadas...)
Sexo: Hombre (Un poco niño, algo adolescente, esencialmente animal, parcialmente antinatural)
Horóscopo: Aries (Debe ser porque soy terco como una cabra)
Año zodiacal: Mono (¿No que hombre, pues?)
Sector: Educación (Es decir, generación de "cambios de conducta")
Profesión: Maestro (Según decían mis condíscipulos: "de obra")
Ubicación: Guatemala (La tierra del árbol de fuego: mi lugar en el Mundo)

lunes, 22 de marzo de 2010

cita petoulquiana: saber y callar

"... Conténtese con el goce del filósofo: saber... y callar."

Pardo Bazán, Emilia. La gota de sangre y otros cuentos policíacos. Grupo Anaya, S. A. Primera edición. Madrid, España. Nov. 2001. p. 109

domingo, 21 de marzo de 2010

Diccionario petoulquiano: Mosca chiclera

Sust. Com. (Entomología empírica chapina) Dícese del díptero que vende chicles, chocolates y cigarrillos (en cajetilla y al menudeo) en las esquinas del centro histórico de la ciudad de Guatemala.

sábado, 20 de marzo de 2010

Paréntesis: De los dos años de Petoulqui...

Y así, sin mayores aspavientos (que quién sabe qué serán... pero se lee bonito), el blog cumplió dos años. Y yo no dije nada; y Vds. (si es que hay alguien ahí leyendo) tampoco lo mencionaron. Supongo que, o no nos importa demasiado o no somos demasiado festivos. En todo caso, me pregunto, ¿hay algo que celebrar?

Han pasado dos años y un poco más de escribir en este blog y he vivido muchos sucesos en la realidad y en el mundo cibernético conocido como blogósfera (tanto chapina como internacional). Cosas buenas y malas (siendo pesimista diría que más han sido las malas, pero siendo honesto: la verdad es que no me han afectado "realmente" la mayoría, sólo cibernéticamente).

Entre las cosas que he encontrado positivas está el hecho de haber podido publicar la mayoría de mis textos, y en algunos casos conocer opiniones interesantes al respecto, más allá del "qué bonito" o "qué porquería".

Sin embargo, lo peor que me ha sucedido en la blogósfera ha sido darme cuenta de que no es este mundo cibernético sino un reflejo del real, igual de cargado con personalidades, algunas que me agradan y luego desagradan y viceversa (y me imagino que algo así ocurrirá a los demás con respecto a mi personalidad).

He visto ir y venir blogs y bloggers (por muchísimas razones que, creo, algún día mencionaré). Con bajo perfil y todo, Las aventuras de Petoulqui sigue aquí.

domingo, 14 de marzo de 2010

capítulo cero: el bloque de hielo

Cuando el corazón es de cristal, su fragilidad está implícita. Así que hacemos lo que sea para protegerlo; somos recelosos, desconfiados, hipersensibles, incluso absurdos y ridículos.

Y cuando alguien fractura el cristal de nuestro corazón, por el temor de que sea destruido por completo, nos aislamos, nos escondemos, hasta que comienza a enfriarse por la falta de compañía y se torna en un translúcido pero duro bloque de hielo.

sábado, 13 de marzo de 2010

capítulo cero: el esqueleto

Sin piel, sin carne, sin vísceras, solamente los huesos: un esqueleto.

Siempre he pensado (sí, siempre, pues siempre generalizo lo que pienso, y como pienso siempre, siempre generalizo) que las cosas deben ser lo más simples posible, sin mayores ornamentos: clásicas (como el arte clásico griego, el período clásico en la música, qué sé yo). Por eso, al leerme, Vds. se podrán encontrar con cierta insipidez, a lo mejor muchos tácitos (ausencias, digamos).

Pero, como siempre (siempre, siempre), hay una contradicción porque, en realidad, soy un romántico (y nada hay más opuesto al clasicismo que el romanticismo [bueno, a lo mejor le es más contrastante el barroquismo]); y no soy exactamente lo que se podría denominar breve en mis conversaciones y escritos.

Así que, soy y no soy un esqueleto. Un esqueleto con panza, digamos. Lo que implica ciertas vísceras: lengua, tracto digestivo, hasta llegar a las gónadas (supongo que la visión de semejante monstruosidad podría disgustar a las personas más sensibles).

Ser o no ser un esqueleto, esa es la cuestión. No implica una decisión, no son dos opciones, es una sola condición. Corrijamos: Ser y no ser un esqueleto.

sábado, 13 de febrero de 2010

cita petoulquiana: grandeza y libertad

"Las almas bajas no creen en los grandes hombres. Los viles esclavos sonríen con aire burlón ante la palabra libertad."

Rosseau, Jean-Jacques. El Contrato Social. Longseller. Primera Edición. Buenos Aires, Argentina. 2005. p.p. 143-144

martes, 9 de febrero de 2010

Versificación III: Eyesub

Eyesub,
Eyesub,
Eyesub,
Buseye

Eye, eye, eye
Eye, eye,
Sub, sub,
Sub, sub, sub

Buseye,
Subeye,
Subeye,
Eyesub

miércoles, 3 de febrero de 2010

Cuento Original: Foto de estudio

Jugó con nuestras más preciadas emociones, con nuestros más puros afectos. Cuando utilizamos el “más” estamos implícitamente comparando y el comparar adultera de manera inevitable. Así que cuando escribo nuestros más puros afectos, sé que no son puros, digamos que no son puramente puros para redundar un poco... sí, no son absolutamente puros, pero son de alguna manera puros... Y el tipo comerció con nuestros más puros afectos, con nuestras emociones más preciadas.

Nos ofreció cuatro fotografías tamaño cédula gratuitamente. Asistimos a la sesión fotográfica, en la cual el tipo se portó totalmente profesional, y como los nativos americanos temían, o eso es lo que me han contado, se robó un poco del alma de mi niña y la metió en una plancha de papel fotográfico. Tornó la vida de mi hija en algo bidimensional, congeló su risa (la de ella, claro es), una parte de mi niña la encerró en papel mate.

Y así, cuando ya había revelado las fotos, bueno, más bien, por ser tan actual la cosa, cuando ya las había impreso, tras un excelente trabajo de diseñador o lo que sea que haga el tipo, nos llamó y enseñó uno de esas fototas en las que salen varios rostros de niños con diversas expresiones, otra foto, también grande, de mi hija en una pose angelical, luciendo además hermosísima (orgullo de padre) y el jueguito de fotos regaladas. Nos dijo que las ampliaciones costaban un dineral, pero que si no las queríamos él había de desecharlas (era como para preguntarle, “y entonces, si no estaba seguro de que las querríamos ¿para qué las sacó?” ah, pero la pregunta hubiera sido necia, él sabía que las querríamos, ¿qué padres y abuelos permitirían que el alma de su pequeña se convirtiera en cenizas por unas cuantas monedas. Nosotros no, por supuesto).

No, si lo malo no es que nos vendan algo (ni que nosotros lo compremos, en todo caso). Lo malo es que lo que nos venda sea el alma, que no nos robó sino más bien nos estafó.

Pagado el rescate, con el alma recuperada, con la imagen conseguida, pudimos irnos tranquilos, aún cuando un poco más pobres y endeudados. Así es esto, ya lo sabemos. Así pasa cuando se lleva un niño a tomarse una foto de estudio gratuita.

domingo, 24 de enero de 2010

cita petoulquiana: azar

"Barajar los naipes es algo, en otro plano, como ver romperse las olas de la mar en la arena de la playa. Y ambas cosas nos hablan de la naturaleza en la historia, del azar de la libertad... En el arte supremo de aprovechar el azar, la superioridad del jugador consiste en resolverse a abandonar a tiempo la partida para poder empezar otra. Y lo mismo en la política y en la vida."

Cómo se hace una novela - Miguel de Unamuno y Jugo

jueves, 14 de enero de 2010

Cuento Original: Justo cuando abrí el paraguas

Había abierto mi paraguas, estaba decidido a retirarme, entonces la vi… (cerré el paraguas) y no supe qué (más) hacer, excepto quedármele mirando: Estaba bajo la lluvia. Simplemente bajo la lluvia. Sin nadie alrededor (todos habían buscado refugio para no quedar empapados, ella no).

Repentinamente, varias preguntas aparecieron en mi mente.

La primera fue, “¿Qué está haciendo ahí?”. Si Vds. la hubieran visto, quizás me entenderían, quizás (A veces ni yo mismo lo entiendo. Ni yo mismo me entiendo, a decir verdad).

Y la segunda, “¿Por qué está ahí?”. El hecho de estar ella ahí, bajo la lluvia, empapándose, en determinado momento viendo hacia el cielo, cerrando sus ojos y expresando mediante cierta calma en su rostro que se sentía extasiada, me pareció menos importante que la razón por la cual estaba ahí, ¿cuál era el motivo que la impulsaba a estar bajo la lluvia, sencillamente mojándose?

Y a éstas siguieron otras, por supuesto, pero tan poco importantes que ya las he olvidado. Digamos que carecían de importancia histórica.

¿Qué hacer? Me lo preguntaba una y otra vez.

Acababa de mejorarme de una gripe terrible. A lo mejor alguno de Vds., caros lectores, alguna vez haya padecido de gripe, pero no de gripe terrible, puesto que ésta es como l’enfant terrible de las gripes. Es tremenda.

Casi nunca tengo gripe, pero cuando me da, cuando me invade más bien, no es una guerra, es una masacre, y la víctima soy yo. Eso es todo.

Por lo anterior, la pregunta “¿qué hacer?” no era una fácil de responder.

Acercarme, en todo caso, implicaba gran peligro para mi salud. Ya ven que no era cosa sencilla.

Aparte estaba el factor, ¿por qué carajos podría ser una buena idea el acercarme?, además, ¿para qué? ¿qué esperaba lograr con ello?

Ah, pero ésta era una pregunta que sí tenía fácil respuesta. Y si no se la daba era por cobardía, por no atreverme a confrontar el hecho. La razón que me obligaba, que me compelía a acercarme, era que aquella escena, esa mujer empapándose bajo aquel diluvio, por lo extraño que se presentaba ante mis ojos, ante mi alma, resultaba algo completamente fascinante. La naturaleza de mi impresión, por supuesto es inefable (sólo palabritas, ¿no es cierto?). Pero, ejemplifiquémoslo de esta manera, yo me sentía como una polilla atraída hacia la luz de una vela (lindísimo lugar común, ¿verdad?).

Sin pensarlo más, harto ante mi propia indecisión, me acerqué tratando de no mojarme demasiado (en esto, fallé en lo poco, en lo mucho y en lo absoluto) para no caer víctima otra vez de mi temido enfant.

Estando a la par de ella, sin decir nada, y por quién sabe qué estúpida causa, cometí el más grave error de esta narración. Un acto comparable, qué sé yo, con Pandora abriendo la caja o con la infamia de mezclar un buen ron con Caca Cola:

Abrí mi paraguas sobre ella.

Eso fue todo.

La magia murió. Esa noche, en ese justo momento murieron no sé cuántas hadas, se les rompió el corazón (y toda esa parafernalia de tipo modernista…).

Justo cuando abrí el paraguas dejó de llover…

O bien:

Justo cuando abrí el paraguas fue como despertar de un sueño….

O:

Justo cuando abrí el paraguas este cuento se acabó.

domingo, 10 de enero de 2010

Paréntesis: Cuadrado, rubio y de ojos azules...


Para las que siempre han soñado con un tipo cuadrado, rubio y de ojos azules...

(Fomería basada en una conversación que tuve con mi hermano)


miércoles, 6 de enero de 2010

capítulo cero: estilo

Me he dado cuenta de que es menos lo que les digo, al escribir, que aquello que dejo para que Vds. se lo imaginen. Es decir, dejo muchos espacios en blanco, para ser rellenados como mejor les parezca. A lo mejor los obligo a pensar, o ése, al final, sería uno de los requerimientos al leer algunas de las cosas que escribo.

Les hablo suponiendo que Vds. están en el mismo contexto que yo, que comprenden las cosas a mi manera, que saben de qué les hablo. Asumo que harán los mismos esfuerzos que yo para llegar a conclusiones, quizás distintas, pero en la misma línea o similar.

Les muestro el silogismo de mi razonamiento, una especie de maquinaria, o el plano de la misma, sin mayores cubiertas, o ninguna, esperando que puedan comprenderla.

Bueno, si les gusta esto, seguramente continuarán leyendo...

domingo, 3 de enero de 2010

Paréntesis: Sehnsucht

"Los alemanes emplean pocas veces la palabra “nostalgia” en su forma griega y prefieren decir Sehnsucht: deseo de lo que está ausente; pero Sehnsucht puede aludir tanto a lo que fue como a lo que nunca ha sido (una nueva aventura), por lo que no implica necesariamente la idea de un nostos; para incluir en la Sehnsucht la obsesión del regreso, habría que añadir un complemento: Senhsucht nach der Vergangenheit, nach der verlorenen Kindheit, o nach der ersten Liebe (deseo del pasado, de la infancia perdida o del primer amor)."

Kundera, Milan. La Ignorancia. Tusquets Editores. Primera Edición. España, 2000. p. 13


...

Pensar demasiado es perjudicial para quien escribe, es decir para mí. Porque si pienso demasiado, a lo mejor decido no escribir, o simplemente borrar lo escrito. Ya saben Vds. que me tomo muy en serio aquello del proverbio arábigo "Amo de mi silencio, esclavo de mis palabras", o algo así lo recuerdo. Pero tomando como base una cita petoulquiana, en este caso de Milan Kundera, a quien respeto considerablemente, aún cuando con ciertas reservas, me atrevo a escribir esto y posteriormente publicarlo. En fin, no es más que un paréntesis, una nota al margen, nada comprometedor.

Es fácil, cuando termina un año y comienza otro, sentir nostalgia. Pero me gusta más esa del tipo del Sehnsucht (¿o debiera decir de la "Sehnsucht", en femenino?), de esa que anhela no solamente lo que fue, sino lo que ya nunca podrá tener, y aún más lo que nunca tuvo y nunca podrá ser.

Hace años encontré un video en Youtube que me pareció fascinante, era de un grupo escandinavo, o así lo recordaba, y en él se mostraba a un grupo de ancianos que jugaba como niños, o eso parecía. Me recordó al filme de Twilight Zone, con los ancianos que rejuvenecen y, pensándolo bien, también era similar a Cocoon. Se lo mostré a mi hermano, nos gustó bastante, pero cometí el error de no guardarlo en mis favoritos. Sin embargo, acostumbrado a las persistentes búsquedas en la red, pensé que sería fácil volver a encontrarlo. No fue así. Pasaron meses tratando de hallarlo y nada, no me resultó aquello de escribir en el motor de búsqueda "old people playing as kids" y cosas similares. Tratar de encontrar el sencillo entre muchísimos grupos de rock, rock-pop, pop-rock, bla, bla, bla, escandinavos en Wikipedia fue igualmente infructuoso. Hoy a las 2 de la mañana o similar, en una de mis búsquedas frenéticas, se me ocurrió escribir en español la siguiente descripción en el motor de búsqueda: "video musical ancianos jugando como niños". Y ¡Zás! apareció esto. En un blog llamado Libro Rojo de la Frontera del Oeste Sueños, discos, películas, y más. 3ª parte de Blog de un Hobbit. Había un post acerca de esta agrupación musical islandesa Sigur Rós, y estaba posteado el video que buscaba y otros más, y más allá de lo que temía, el video todavía funcionaba, fui a Youtube, seleccioné el video en favoritos y lo vi. No me emocionó como antes. Algo había muerto en mí. No en el video, que era exactamente como antes, no digo que como lo recordaba porque no es que tenga memoria fotográfica ni nada. Sin embargo, he querido compartirlo con Vds:



Muy bien, volví a ver el video una vez más, antes de postearlo para Vds. y debo reconocer que me gustó. Supongo que no todo está muerto y que las dos de la mañana no es el mejor momento para ver un video, aparte que no le podía subir mucho al volumen porque las demás personas quieren dormir. En efecto, la música es muy importante para apreciar el video. Y como andamos en ánimo regalón, aún cuando a mí no me gustó demasiado (exceptuando la música), podría ser que a alguno de Vds. sí. Aquí les dejo "El globo rojo" (Le Ballon rouge):





Videos: http://www.youtube.com/watch?v=JAYb8ZyjzD0

http://www.youtube.com/watch?v=aBgHlB6Sh5k